Archives
Influenza Hemagglutinin (HA) Peptide: Precision Tag for P...
Influenza Hemagglutinin (HA) Peptide: Precision Tag for Protein Purification and Detection
Executive Summary: The Influenza Hemagglutinin (HA) Peptide is a nine-amino acid synthetic peptide (sequence: YPYDVPDYA) that acts as a standardized epitope tag for protein detection and purification workflows (APExBIO). Its competitive binding to Anti-HA antibodies enables quantitative elution in immunoprecipitation assays, with a purity exceeding 98% (HPLC/MS) and high solubility across DMSO, ethanol, and water. The HA tag sequence is stably inherited from the human influenza virus hemagglutinin protein and is validated in a broad spectrum of molecular biology protocols (Wei et al., 2021). Proper storage (<-20°C, desiccated) and handling are critical for optimal performance. This article details the biological rationale, molecular action, quantitative benchmarks, and common misconceptions regarding HA tag usage.
Biological Rationale
The HA tag is derived from the influenza virus hemagglutinin protein, specifically residues 98–106 (YPYDVPDYA), and was initially developed to facilitate the detection and purification of recombinant proteins (Wei et al., 2021). Its small size (9 amino acids, ~1 kDa) minimizes perturbation of protein folding and function, making it suitable for N- or C-terminal fusion constructs in eukaryotic and prokaryotic systems. The HA peptide is recognized by highly specific monoclonal Anti-HA antibodies, enabling selective detection and affinity purification of HA-tagged proteins without significant cross-reactivity (APExBIO).
The use of epitope tags like the HA tag supports mechanistic studies of protein-protein interactions, ubiquitination, and post-translational modifications by providing a generic, antibody-accessible marker (Redefining Protein Interaction Discovery). This extends the functional analysis of key signaling pathways, such as those controlling exosome biogenesis and trafficking (Wei et al., 2021).
Mechanism of Action of Influenza Hemagglutinin (HA) Peptide
The HA peptide functions by competitively binding to Anti-HA antibodies, disrupting the antibody-antigen interaction and enabling the elution of HA-tagged fusion proteins from antibody-based matrices (e.g., Anti-HA Magnetic Beads) (APExBIO). This high-affinity binding is due to the precise molecular complementarity between the peptide epitope and the antibody paratope.
During immunoprecipitation, excess synthetic HA peptide (typically at 0.5–2 mg/mL) is introduced to outcompete the immobilized HA-tagged protein, resulting in specific, gentle elution. This preserves protein-protein interactions and post-translational modifications, which is critical for downstream analyses such as mass spectrometry or mechanistic signaling investigations (Leveraging the Influenza Hemagglutinin (HA) Peptide).
The sequence specificity of the HA tag (YPYDVPDYA) ensures minimal off-target interactions, and its solubility profile—≥55.1 mg/mL in DMSO, ≥100.4 mg/mL in ethanol, and ≥46.2 mg/mL in water—supports protocol flexibility in diverse buffer systems. The peptide is supplied at >98% purity, confirmed by HPLC and MS, ensuring batch reproducibility for rigorous scientific workflows (APExBIO).
Evidence & Benchmarks
- The HA tag sequence (YPYDVPDYA) enables specific detection and immunoprecipitation of fusion proteins in mammalian and yeast systems (Wei et al., 2021).
- Competitive elution using synthetic HA peptide preserves native protein complexes, outperforming harsh elution buffers in co-immunoprecipitation assays (Wei et al., 2021).
- Purity of >98% (by HPLC/MS) is achieved in commercial preparations such as APExBIO's A6004 kit (APExBIO).
- Solubility benchmarks: ≥100.4 mg/mL in ethanol, ≥55.1 mg/mL in DMSO, and ≥46.2 mg/mL in water at 20–25°C, supporting direct use in a wide range of immunoprecipitation and elution protocols (APExBIO).
- Validated for use in exosome pathway studies, supporting mechanistic dissection of ESCRT-independent trafficking (Wei et al., 2021).
Applications, Limits & Misconceptions
The Influenza Hemagglutinin (HA) Peptide is widely used as a protein purification tag in immunoprecipitation, western blotting, immunofluorescence, and protein-protein interaction studies (Advanced Strategies for Quantitative Protein Interaction Analysis). It enables detection and enrichment of HA-tagged proteins from complex biological samples, including cell lysates and exosome preparations.
This article extends prior overviews by providing detailed quantitative solubility, purity, and elution performance benchmarks for the A6004 HA tag peptide, clarifying variables that influence reproducibility and specificity.
Common Pitfalls or Misconceptions
- HA peptide does not function as a general affinity ligand; only HA-tagged proteins are effectively eluted.
- Epitope masking can occur if the HA tag is structurally inaccessible (e.g., buried in protein folds), reducing antibody binding efficiency.
- Long-term storage of peptide solutions is not recommended; lyophilized peptide should be stored at -20°C, desiccated, to maintain stability.
- High concentrations (>5 mg/mL) in aqueous buffers may lead to precipitation, especially at low temperatures.
- The HA peptide is not suitable for in vivo systemic administration due to rapid degradation and immunogenicity potential.
Previous articles, such as Influenza Hemagglutinin (HA) Peptide: Precision Tag for D..., describe the value of the HA tag in ubiquitin signaling and metastasis research but do not cover the full spectrum of protocol parameters, which are detailed here.
Workflow Integration & Parameters
The HA tag is genetically encoded into target proteins during cloning via insertion of the corresponding DNA sequence (TACCCATACGATGTTCCAGATTACGCT) at the desired locus. Recombinant expression yields HA-tagged fusion proteins that can be detected and purified using Anti-HA antibody conjugates (APExBIO).
During immunoprecipitation or affinity purification, the Influenza Hemagglutinin (HA) Peptide is typically used at a final concentration of 0.5–2 mg/mL to elute bound protein in a gentle, competitive manner. The choice of buffer (PBS, TBS, or others) should match antibody compatibility and minimize aggregation. HA peptide solutions should be freshly prepared and used within one working day (APExBIO).
For advanced workflows in signaling or exosome biology, the HA tag enables high-fidelity isolation of complexes, supporting downstream analyses by mass spectrometry, immunoblotting, or functional assays. This article updates and expands upon Influenza Hemagglutinin (HA) Peptide: Revolutionizing Protein Complex Analysis by integrating new data on ESCRT-independent exosome pathways and best practices for tag accessibility and elution.
Conclusion & Outlook
The Influenza Hemagglutinin (HA) Peptide, as distributed by APExBIO (A6004), provides a highly standardized and mechanistically validated solution for protein detection and purification. Its robust biophysical properties and sequence specificity enable reproducible and gentle isolation of HA-tagged fusion proteins, supporting a broad range of molecular biology, signaling, and exosome research applications. Future developments may include the integration of orthogonal tags and further optimization for multiplexed protein complex analyses. For product details and ordering information, see the Influenza Hemagglutinin (HA) Peptide product page.